Transcript: Human XM_017010477.1

PREDICTED: Homo sapiens regulatory factor X6 (RFX6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFX6 (222546)
Length:
3314
CDS:
249..2657

Additional Resources:

NCBI RefSeq record:
XM_017010477.1
NBCI Gene record:
RFX6 (222546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017420 GCAGGAGTTACAGAATTTATT pLKO.1 1505 CDS 100% 15.000 12.000 N RFX6 n/a
2 TRCN0000427471 TTGACCAGCATGTCGTTAATT pLKO_005 1072 CDS 100% 15.000 10.500 N RFX6 n/a
3 TRCN0000435197 ACAAGGTTGATACGCTCATAA pLKO_005 646 CDS 100% 13.200 9.240 N RFX6 n/a
4 TRCN0000416382 TCGAATGCTTCTCGATGAATA pLKO_005 1442 CDS 100% 13.200 9.240 N RFX6 n/a
5 TRCN0000017419 CCACTCCGTTTATTCTGGAAA pLKO.1 482 CDS 100% 4.950 3.465 N RFX6 n/a
6 TRCN0000017421 CCCAATGTATGTATGGAACTT pLKO.1 2518 CDS 100% 4.950 3.465 N RFX6 n/a
7 TRCN0000017422 GCATAATCTCACCTTGAACAA pLKO.1 1391 CDS 100% 4.950 3.465 N RFX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09881 pDONR223 100% 86.3% 86.2% None 1_2delATins380;1684A>G n/a
2 ccsbBroad304_09881 pLX_304 0% 86.3% 86.2% V5 1_2delATins380;1684A>G n/a
3 TRCN0000468782 CCTCTGGACCCAAGGTCATGTAGC pLX_317 .7% 86.3% 86.2% V5 1_2delATins380;1684A>G n/a
Download CSV