Transcript: Human XM_017010744.2

PREDICTED: Homo sapiens TNF receptor superfamily member 21 (TNFRSF21), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFRSF21 (27242)
Length:
1775
CDS:
400..1734

Additional Resources:

NCBI RefSeq record:
XM_017010744.2
NBCI Gene record:
TNFRSF21 (27242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059135 CCTATGTCTCTGAGCATTGTA pLKO.1 620 CDS 100% 5.625 3.938 N TNFRSF21 n/a
2 TRCN0000290469 CCTATGTCTCTGAGCATTGTA pLKO_005 620 CDS 100% 5.625 3.938 N TNFRSF21 n/a
3 TRCN0000066601 CCGGGAGAAATGGATCTACTA pLKO.1 1608 CDS 100% 4.950 3.465 N Tnfrsf21 n/a
4 TRCN0000059137 CCAACTCTTCTGCCTCTGTTA pLKO.1 1166 CDS 100% 4.950 2.970 N TNFRSF21 n/a
5 TRCN0000290470 CCAACTCTTCTGCCTCTGTTA pLKO_005 1166 CDS 100% 4.950 2.970 N TNFRSF21 n/a
6 TRCN0000059136 CCTCGAATCTCATTGGCACAT pLKO.1 539 CDS 100% 4.050 2.430 N TNFRSF21 n/a
7 TRCN0000290467 CCTCGAATCTCATTGGCACAT pLKO_005 539 CDS 100% 4.050 2.430 N TNFRSF21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14122 pDONR223 100% 37.1% 35.3% None (many diffs) n/a
2 ccsbBroad304_14122 pLX_304 0% 37.1% 35.3% V5 (many diffs) n/a
3 TRCN0000469853 GACACTCCACTGTCACTATATCAA pLX_317 37% 37.1% 35.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV