Transcript: Human XM_017010753.2

PREDICTED: Homo sapiens glycosylphosphatidylinositol specific phospholipase D1 (GPLD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPLD1 (2822)
Length:
7838
CDS:
223..2775

Additional Resources:

NCBI RefSeq record:
XM_017010753.2
NBCI Gene record:
GPLD1 (2822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050819 CGGCCGAGTATATGTATATAA pLKO.1 2517 CDS 100% 15.000 21.000 N GPLD1 n/a
2 TRCN0000372375 CTCGCTCCCTTTGCATCTAAA pLKO_005 3031 3UTR 100% 13.200 18.480 N GPLD1 n/a
3 TRCN0000372374 ACGTACGATGACGTGTCTAAG pLKO_005 2266 CDS 100% 10.800 15.120 N GPLD1 n/a
4 TRCN0000050822 CCAGGACATCTACTGTAACTT pLKO.1 1770 CDS 100% 5.625 7.875 N GPLD1 n/a
5 TRCN0000378772 GCTAGCTGTTTCCAAGTTATA pLKO_005 918 CDS 100% 13.200 9.240 N GPLD1 n/a
6 TRCN0000050820 CGTTCATTATATCCGAGAGAA pLKO.1 540 CDS 100% 4.950 3.465 N GPLD1 n/a
7 TRCN0000050818 GCTCCTATTCAGAGGCTCATT pLKO.1 707 CDS 100% 4.950 3.465 N GPLD1 n/a
8 TRCN0000050821 GCTGGGCCATTTGTTACACAT pLKO.1 2073 CDS 100% 4.950 3.465 N GPLD1 n/a
9 TRCN0000190048 GACCTGGATGATGATGGCTTA pLKO.1 2428 CDS 100% 4.050 2.835 N Gpld1 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4128 3UTR 100% 4.950 2.475 Y n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4201 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4201 3UTR 100% 5.625 2.813 Y EID2B n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 4036 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06305 pDONR223 100% 19.8% 18.9% None (many diffs) n/a
2 ccsbBroad304_06305 pLX_304 0% 19.8% 18.9% V5 (many diffs) n/a
3 TRCN0000474527 TCCGAAAATTGTGCCTTAACGAGC pLX_317 59.1% 19.8% 18.9% V5 (many diffs) n/a
Download CSV