Transcript: Human XM_017010820.1

PREDICTED: Homo sapiens colipase like 1 (CLPSL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLPSL1 (340204)
Length:
644
CDS:
125..502

Additional Resources:

NCBI RefSeq record:
XM_017010820.1
NBCI Gene record:
CLPSL1 (340204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154272 GCGGAACCTGACTTGTATATA pLKO.1 394 CDS 100% 15.000 21.000 N CLPSL1 n/a
2 TRCN0000157751 CTGCGGAACCTGACTTGTATA pLKO.1 392 CDS 100% 13.200 18.480 N CLPSL1 n/a
3 TRCN0000151197 GAATGAGAAATGGCTTAGCAT pLKO.1 421 CDS 100% 3.000 4.200 N CLPSL1 n/a
4 TRCN0000151684 CGGAACCTGACTTGTATATAT pLKO.1 395 CDS 100% 15.000 12.000 N CLPSL1 n/a
5 TRCN0000153950 CAGGTGTTCTTTGGCCAATAT pLKO.1 356 CDS 100% 13.200 9.240 N CLPSL1 n/a
6 TRCN0000157542 GCAGGTGTTCTTTGGCCAATA pLKO.1 355 CDS 100% 10.800 7.560 N CLPSL1 n/a
7 TRCN0000157646 GTGTCAAACGCAGGTGTTCTT pLKO.1 346 CDS 100% 4.950 3.465 N CLPSL1 n/a
8 TRCN0000156730 GAAGGCAGAAGTTGGCTAAGA pLKO.1 468 CDS 100% 4.950 2.970 N CLPSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05469 pDONR223 100% 70.9% 64.7% None (many diffs) n/a
2 ccsbBroad304_05469 pLX_304 0% 70.9% 64.7% V5 (many diffs) n/a
3 TRCN0000475797 TTACTGGTTTAACGATTTGGTCTT pLX_317 55.9% 70.9% 64.7% V5 (many diffs) n/a
Download CSV