Transcript: Human XM_017010881.1

PREDICTED: Homo sapiens afadin, adherens junction formation factor (AFDN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AFDN (4301)
Length:
7825
CDS:
245..5737

Additional Resources:

NCBI RefSeq record:
XM_017010881.1
NBCI Gene record:
AFDN (4301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294097 TTATCCCAACGGATCTTATAG pLKO_005 2940 CDS 100% 13.200 18.480 N AFDN n/a
2 TRCN0000117378 GCGTCCCATGTATTTAAGTTT pLKO.1 1718 CDS 100% 5.625 7.875 N AFDN n/a
3 TRCN0000117380 CTGCCCTATTTAGTAGAGTTA pLKO.1 1391 CDS 100% 4.950 6.930 N AFDN n/a
4 TRCN0000286748 CTGCCCTATTTAGTAGAGTTA pLKO_005 1391 CDS 100% 4.950 6.930 N AFDN n/a
5 TRCN0000117379 GCATCGAATAGAGGCAGCTAT pLKO.1 4129 CDS 100% 4.950 6.930 N AFDN n/a
6 TRCN0000298255 GCATCGAATAGAGGCAGCTAT pLKO_005 4129 CDS 100% 4.950 6.930 N AFDN n/a
7 TRCN0000306872 ATCGTGCAGGCAACGACTTTG pLKO_005 2798 CDS 100% 10.800 7.560 N AFDN n/a
8 TRCN0000117381 CCAAAGAAATTGCCTGGTGAT pLKO.1 3722 CDS 100% 4.050 2.835 N AFDN n/a
9 TRCN0000286823 CCAAAGAAATTGCCTGGTGAT pLKO_005 3722 CDS 100% 4.050 2.835 N AFDN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.