Transcript: Human XM_017010935.1

PREDICTED: Homo sapiens phosphoglucomutase 3 (PGM3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGM3 (5238)
Length:
3099
CDS:
128..1585

Additional Resources:

NCBI RefSeq record:
XM_017010935.1
NBCI Gene record:
PGM3 (5238)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304020 GACAAGATAGCAACGTTAATT pLKO_005 779 CDS 100% 15.000 21.000 N PGM3 n/a
2 TRCN0000049055 GCTGGTGATTGAAGCAATCTT pLKO.1 1153 CDS 100% 5.625 3.938 N PGM3 n/a
3 TRCN0000310637 GCTGGTGATTGAAGCAATCTT pLKO_005 1153 CDS 100% 5.625 3.938 N PGM3 n/a
4 TRCN0000049054 CCAATGAAAGATGCTGTTCTT pLKO.1 687 CDS 100% 4.950 3.465 N PGM3 n/a
5 TRCN0000174095 CCAATGAAAGATGCTGTTCTT pLKO.1 687 CDS 100% 4.950 3.465 N PGM3 n/a
6 TRCN0000049053 GCAGTGAGAAACTTTCACAAT pLKO.1 279 CDS 100% 4.950 3.465 N PGM3 n/a
7 TRCN0000300585 GCAGTGAGAAACTTTCACAAT pLKO_005 279 CDS 100% 4.950 3.465 N PGM3 n/a
8 TRCN0000049057 GCTAAGGGAAATGGAACACTA pLKO.1 544 CDS 100% 4.950 3.465 N PGM3 n/a
9 TRCN0000300586 GCTAAGGGAAATGGAACACTA pLKO_005 544 CDS 100% 4.950 3.465 N PGM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06719 pDONR223 100% 81.2% 81% None (many diffs) n/a
2 ccsbBroad304_06719 pLX_304 0% 81.2% 81% V5 (many diffs) n/a
3 TRCN0000474277 CAAGCCTGTGAGCAACCTTCGGAT pLX_317 35.3% 81.2% 81% V5 (many diffs) n/a
Download CSV