Transcript: Human XM_017010956.2

PREDICTED: Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TREM1 (54210)
Length:
5647
CDS:
38..742

Additional Resources:

NCBI RefSeq record:
XM_017010956.2
NBCI Gene record:
TREM1 (54210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056753 CCGGTGTTCAACATTGTCATT pLKO.1 641 CDS 100% 4.950 6.930 N TREM1 n/a
2 TRCN0000373809 TCCGAGCTGCAACTAAATTAA pLKO_005 90 CDS 100% 15.000 12.000 N TREM1 n/a
3 TRCN0000373807 AGGCCTTGTGCCCACTCTATA pLKO_005 516 CDS 100% 13.200 9.240 N TREM1 n/a
4 TRCN0000056754 CCAGAAAGCTTGGCAGATAAT pLKO.1 190 CDS 100% 13.200 9.240 N TREM1 n/a
5 TRCN0000056757 GTCAACCTTCAAGTGGAAGAT pLKO.1 338 CDS 100% 4.950 3.465 N TREM1 n/a
6 TRCN0000056755 CCTGACTCTGAAATCAACCTT pLKO.1 593 CDS 100% 3.000 2.100 N TREM1 n/a
7 TRCN0000056756 GCTGAGGTCATTTGTACCCTA pLKO.1 721 CDS 100% 2.640 1.848 N TREM1 n/a
8 TRCN0000373808 GGCAGACCCTGGATGTGAAAT pLKO_005 138 CDS 100% 13.200 7.920 N TREM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03407 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03407 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471196 TGGACTCTATGCCGTACTACTTGC pLX_317 49.8% 100% 100% V5 n/a
Download CSV