Transcript: Human XM_017010962.2

PREDICTED: Homo sapiens coiled-coil alpha-helical rod protein 1 (CCHCR1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCHCR1 (54535)
Length:
2739
CDS:
238..2586

Additional Resources:

NCBI RefSeq record:
XM_017010962.2
NBCI Gene record:
CCHCR1 (54535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139799 CCCTTTCAACTCTGCCAAGAA pLKO.1 296 CDS 100% 4.950 3.960 N CCHCR1 n/a
2 TRCN0000141626 CTGAGTGAAGCCATTTCCAAA pLKO.1 2497 CDS 100% 4.950 3.465 N CCHCR1 n/a
3 TRCN0000140482 GTTGTCCGGAAGAACTTGGAA pLKO.1 700 CDS 100% 3.000 2.100 N CCHCR1 n/a
4 TRCN0000139740 CTGAGTAGTCTGGAAACCAGA pLKO.1 847 CDS 100% 2.640 1.848 N CCHCR1 n/a
5 TRCN0000139942 GAAGTCTCTGAGTAGTCTGGA pLKO.1 840 CDS 100% 2.640 1.848 N CCHCR1 n/a
6 TRCN0000140529 GAGGAAGCTGTTTGTCAAGGA pLKO.1 2518 CDS 100% 2.640 1.848 N CCHCR1 n/a
7 TRCN0000140604 GAGGGATAAGAACCTCATGCT pLKO.1 2268 CDS 100% 2.640 1.848 N CCHCR1 n/a
8 TRCN0000140110 GCCATTTCCAAAGAGGAAGCT pLKO.1 2506 CDS 100% 2.640 1.848 N CCHCR1 n/a
9 TRCN0000142543 GTTTGTCAAGGAGACAACCTT pLKO.1 2527 CDS 100% 0.300 0.210 N CCHCR1 n/a
10 TRCN0000139691 CAAGGAGACAACCTTGACAGA pLKO.1 2533 CDS 100% 0.264 0.185 N CCHCR1 n/a
11 TRCN0000140708 GTGACCCTGGTTGAGAATCTA pLKO.1 964 CDS 100% 5.625 3.375 N CCHCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12055 pDONR223 100% 94.7% 94.2% None (many diffs) n/a
2 ccsbBroad304_12055 pLX_304 0% 94.7% 94.2% V5 (many diffs) n/a
3 TRCN0000466341 AGCACCTTTCGTAAGCCTAGTAAC pLX_317 17.5% 94.7% 94.2% V5 (many diffs) n/a
Download CSV