Transcript: Human XM_017011151.1

PREDICTED: Homo sapiens ABRA C-terminal like (ABRACL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABRACL (58527)
Length:
830
CDS:
186..431

Additional Resources:

NCBI RefSeq record:
XM_017011151.1
NBCI Gene record:
ABRACL (58527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263956 TCCTCTTCCGTGATGATAAAT pLKO_005 280 CDS 100% 15.000 10.500 N ABRACL n/a
2 TRCN0000263957 TTCTGGTAAACTGGAATATAA pLKO_005 469 3UTR 100% 15.000 10.500 N ABRACL n/a
3 TRCN0000263958 ATGGAAAGTTAAGCGTGAAAT pLKO_005 253 CDS 100% 13.200 9.240 N ABRACL n/a
4 TRCN0000263959 GCATTGGTAGGAACTCTTAAA pLKO_005 318 CDS 100% 13.200 9.240 N ABRACL n/a
5 TRCN0000263955 TGCAAGATTAATGTGGTTTAC pLKO_005 421 CDS 100% 10.800 6.480 N ABRACL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14238 pDONR223 100% 98.7% 98.7% None 212_214delATG n/a
2 ccsbBroad304_14238 pLX_304 0% 98.7% 98.7% V5 212_214delATG n/a
3 TRCN0000469290 CTCAAGAGATTGGCTGTCACCGCA pLX_317 100% 98.7% 98.7% V5 212_214delATG n/a
Download CSV