Transcript: Human XM_017011279.2

PREDICTED: Homo sapiens BCL2 associated athanogene 6 (BAG6), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAG6 (7917)
Length:
4234
CDS:
594..4142

Additional Resources:

NCBI RefSeq record:
XM_017011279.2
NBCI Gene record:
BAG6 (7917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007354 GCCATTCCCATACAGATCAAT pLKO.1 1695 CDS 100% 5.625 7.875 N BAG6 n/a
2 TRCN0000279903 GCCATTCCCATACAGATCAAT pLKO_005 1695 CDS 100% 5.625 7.875 N BAG6 n/a
3 TRCN0000007353 GCTGTTATCAATGGCCGAATT pLKO.1 3420 CDS 100% 0.000 0.000 N BAG6 n/a
4 TRCN0000279975 GCTGTTATCAATGGCCGAATT pLKO_005 3420 CDS 100% 0.000 0.000 N BAG6 n/a
5 TRCN0000007357 CCTATTATCCAGCAGGACATT pLKO.1 3801 CDS 100% 4.950 3.465 N BAG6 n/a
6 TRCN0000279904 CCTATTATCCAGCAGGACATT pLKO_005 3801 CDS 100% 4.950 3.465 N BAG6 n/a
7 TRCN0000007356 CAGTGAAAGTATTGCTGCCTT pLKO.1 2909 CDS 100% 2.640 1.848 N BAG6 n/a
8 TRCN0000007355 CCTTGGACTCTCAAACTCGTA pLKO.1 661 CDS 100% 2.640 1.848 N BAG6 n/a
9 TRCN0000279905 CCTTGGACTCTCAAACTCGTA pLKO_005 661 CDS 100% 2.640 1.848 N BAG6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01841 pDONR223 100% 95.2% 95.2% None 1368_1394del;1474_1614del n/a
2 ccsbBroad304_01841 pLX_304 0% 95.2% 95.2% V5 1368_1394del;1474_1614del n/a
3 TRCN0000479428 CAAACTTTCCGCGCCATGCGTCGA pLX_317 .6% 95.2% 95.2% V5 1368_1394del;1474_1614del n/a
Download CSV