Transcript: Human XM_017011332.1

PREDICTED: Homo sapiens megakaryocyte and platelet inhibitory receptor G6b (MPIG6B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPIG6B (80739)
Length:
1049
CDS:
27..728

Additional Resources:

NCBI RefSeq record:
XM_017011332.1
NBCI Gene record:
MPIG6B (80739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263692 TTCGACCACTCCCTAGATTTG pLKO_005 504 CDS 100% 10.800 15.120 N MPIG6B n/a
2 TRCN0000122521 CCACATAGCTCCACTTGTGAA pLKO.1 536 CDS 100% 4.950 6.930 N MPIG6B n/a
3 TRCN0000263690 CCACATAGCTCCACTTGTGAA pLKO_005 536 CDS 100% 4.950 6.930 N MPIG6B n/a
4 TRCN0000122552 CACTCCCTAGATTTGCTCTGT pLKO.1 510 CDS 100% 2.640 3.696 N MPIG6B n/a
5 TRCN0000263691 ACGCTCCCTGGACTCTGGTAT pLKO_005 326 CDS 100% 1.650 1.155 N MPIG6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09040 pDONR223 100% 67.3% 47.1% None (many diffs) n/a
2 ccsbBroad304_09040 pLX_304 0% 67.3% 47.1% V5 (many diffs) n/a
3 TRCN0000469958 TCGGTTATCAAGTTAACCCTCTGT pLX_317 59.6% 67.3% 47.1% V5 (many diffs) n/a
Download CSV