Transcript: Human XM_017011497.1

PREDICTED: Homo sapiens synaptotagmin like 3 (SYTL3), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYTL3 (94120)
Length:
3934
CDS:
1026..2240

Additional Resources:

NCBI RefSeq record:
XM_017011497.1
NBCI Gene record:
SYTL3 (94120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011497.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437661 AGGTCAGTGCACCAGATATTC pLKO_005 1129 CDS 100% 13.200 18.480 N SYTL3 n/a
2 TRCN0000179386 GAGAAATACGAAGACAGCGTT pLKO.1 1719 CDS 100% 2.640 3.696 N SYTL3 n/a
3 TRCN0000433067 ATCACTTCATGGTCAACTTTG pLKO_005 1835 CDS 100% 10.800 8.640 N SYTL3 n/a
4 TRCN0000147564 GCACCTTGAACTCATTTGTTA pLKO.1 1900 CDS 100% 5.625 3.938 N SYTL3 n/a
5 TRCN0000150165 CAAATGCTCTACTAACCCTAT pLKO.1 1175 CDS 100% 4.050 2.835 N SYTL3 n/a
6 TRCN0000181018 CGGAGAGTGTTTCTTGGAGAA pLKO.1 1617 CDS 100% 4.050 2.835 N SYTL3 n/a
7 TRCN0000422165 GTGCTAGGAGCCAAGAATTTA pLKO_005 1863 CDS 100% 15.000 9.000 N SYTL3 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3096 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3096 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011497.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13004 pDONR223 100% 66.1% 66% None 0_1ins618;1026A>G;1142T>A n/a
2 ccsbBroad304_13004 pLX_304 0% 66.1% 66% V5 0_1ins618;1026A>G;1142T>A n/a
3 TRCN0000468926 GAGGACAAGAGTTATGCAACAACC pLX_317 23.9% 66.1% 66% V5 0_1ins618;1026A>G;1142T>A n/a
Download CSV