Transcript: Human XM_017011505.1

PREDICTED: Homo sapiens lymphocyte antigen 86 (LY86), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LY86 (9450)
Length:
850
CDS:
97..666

Additional Resources:

NCBI RefSeq record:
XM_017011505.1
NBCI Gene record:
LY86 (9450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139706 CTGAGAGAGGACATCAAAGAG pLKO.1 316 CDS 100% 4.950 3.465 N LY86 n/a
2 TRCN0000142534 GAGAGGACATCAAAGAGCTTT pLKO.1 320 CDS 100% 4.950 3.465 N LY86 n/a
3 TRCN0000141862 GAATTTCTCCTATCCCATCTG pLKO.1 381 CDS 100% 4.050 2.835 N LY86 n/a
4 TRCN0000143428 GAATTATTCTGAGAGAGGACA pLKO.1 308 CDS 100% 2.640 1.848 N LY86 n/a
5 TRCN0000141393 CTTTCTGTGGAAGAAGGAAAG pLKO.1 425 CDS 100% 0.600 0.360 N LY86 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02166 pDONR223 100% 73.8% 62.5% None (many diffs) n/a
2 ccsbBroad304_02166 pLX_304 0% 73.8% 62.5% V5 (many diffs) n/a
3 TRCN0000471492 AGAACTTATATGCAACAGCTCAAG pLX_317 90.9% 73.8% 62.5% V5 (many diffs) n/a
Download CSV