Transcript: Human XM_017011516.2

PREDICTED: Homo sapiens WT1 associated protein (WTAP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WTAP (9589)
Length:
1452
CDS:
116..679

Additional Resources:

NCBI RefSeq record:
XM_017011516.2
NBCI Gene record:
WTAP (9589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231424 GCAAGAGTGTACTACTCAAAT pLKO_005 427 CDS 100% 13.200 18.480 N WTAP n/a
2 TRCN0000231423 GGCAAGTACACAGATCTTAAC pLKO_005 290 CDS 100% 10.800 8.640 N WTAP n/a
3 TRCN0000306167 GGTGAACTGGAACAGACTAAA pLKO_005 542 CDS 100% 13.200 9.240 N Wtap n/a
4 TRCN0000001077 GTTATGGCAAGAGATGAGTTA pLKO.1 224 CDS 100% 4.950 3.465 N WTAP n/a
5 TRCN0000231422 ATGGCAAGAGATGAGTTAATT pLKO_005 227 CDS 100% 15.000 9.000 N WTAP n/a
6 TRCN0000124350 CCTGGAAGTTTACGCCTGATA pLKO.1 597 CDS 100% 4.950 2.970 N Wtap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02205 pDONR223 100% 80.5% 80.7% None 1_51del;504_561delinsG n/a
2 ccsbBroad304_02205 pLX_304 0% 80.5% 80.7% V5 1_51del;504_561delinsG n/a
3 TRCN0000472743 TCTCTAGTGGTGCGCTGTTTATAC pLX_317 100% 80.5% 80.7% V5 1_51del;504_561delinsG n/a
Download CSV