Transcript: Human XM_017011721.1

PREDICTED: Homo sapiens chimerin 2 (CHN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHN2 (1124)
Length:
3342
CDS:
15..1742

Additional Resources:

NCBI RefSeq record:
XM_017011721.1
NBCI Gene record:
CHN2 (1124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047742 GCATTCGGGAAATTGAAGCAA pLKO.1 1225 CDS 100% 3.000 4.200 N CHN2 n/a
2 TRCN0000047738 CCAATGTCTATCCAGACATAA pLKO.1 1351 CDS 100% 1.320 1.848 N CHN2 n/a
3 TRCN0000047740 GACCTTAAACTACAGGCTCTT pLKO.1 638 CDS 100% 4.050 2.835 N CHN2 n/a
4 TRCN0000047739 CCATCTATGAACACATTGGAT pLKO.1 787 CDS 100% 3.000 2.100 N CHN2 n/a
5 TRCN0000047741 CGTACACAAACAGTGTTCCAA pLKO.1 1088 CDS 100% 3.000 2.100 N CHN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477804 GCCGCGAGTCAAACACCACACCAG pLX_317 34% 80.5% 78.9% V5 (many diffs) n/a
2 ccsbBroadEn_05996 pDONR223 100% 80.4% 78.7% None (many diffs) n/a
3 ccsbBroad304_05996 pLX_304 0% 80.4% 78.7% V5 (many diffs) n/a
Download CSV