Transcript: Human XM_017011799.2

PREDICTED: Homo sapiens zinc finger protein 467 (ZNF467), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF467 (168544)
Length:
3805
CDS:
961..3273

Additional Resources:

NCBI RefSeq record:
XM_017011799.2
NBCI Gene record:
ZNF467 (168544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107932 CGCAAGAAGACGCACTTGATT pLKO.1 2329 CDS 100% 5.625 4.500 N ZNF467 n/a
2 TRCN0000107931 GCTGTCAGTCTGTCAGTCTTT pLKO.1 1536 CDS 100% 4.950 3.960 N ZNF467 n/a
3 TRCN0000107930 ACCCTTTCTTGCCCACAGTTT pLKO.1 3291 3UTR 100% 4.950 3.465 N ZNF467 n/a
4 TRCN0000107933 TCGCAAGAAGACGCACTTGAT pLKO.1 2328 CDS 100% 4.950 3.465 N ZNF467 n/a
5 TRCN0000107934 GTGGATGATTCGGAAGGTGAA pLKO.1 1755 CDS 100% 4.050 2.835 N ZNF467 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05144 pDONR223 100% 72.3% 67.6% None (many diffs) n/a
2 ccsbBroad304_05144 pLX_304 0% 72.3% 67.6% V5 (many diffs) n/a
3 TRCN0000477927 GAGGTTATGTATTCTAGGAGATGG pLX_317 13.7% 72.3% 67.6% V5 (many diffs) n/a
Download CSV