Transcript: Human XM_017011911.1

PREDICTED: Homo sapiens hyaluronidase 4 (HYAL4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HYAL4 (23553)
Length:
2113
CDS:
342..1787

Additional Resources:

NCBI RefSeq record:
XM_017011911.1
NBCI Gene record:
HYAL4 (23553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434457 ACTTCATGGCTCCTTATATTT pLKO_005 399 CDS 100% 15.000 21.000 N HYAL4 n/a
2 TRCN0000435653 GCATTCAGTTGTGAGATAATT pLKO_005 1774 CDS 100% 15.000 21.000 N HYAL4 n/a
3 TRCN0000420202 AGAAGTCAAGAAAGCTTATTT pLKO_005 835 CDS 100% 15.000 10.500 N HYAL4 n/a
4 TRCN0000414681 CCTGCTCGACTTCCAATTTAT pLKO_005 450 CDS 100% 15.000 10.500 N HYAL4 n/a
5 TRCN0000219833 ATGTATCAGCTACCGATATTG pLKO.1 871 CDS 100% 13.200 9.240 N HYAL4 n/a
6 TRCN0000147059 CTCCCACAGAACATAAGTTTA pLKO.1 675 CDS 100% 13.200 9.240 N HYAL4 n/a
7 TRCN0000219834 TGCCACAATTATAACGTTTAT pLKO.1 1008 CDS 100% 13.200 9.240 N HYAL4 n/a
8 TRCN0000147034 CCAACAGATCAGTGTTTGATA pLKO.1 504 CDS 100% 5.625 3.938 N HYAL4 n/a
9 TRCN0000182886 CCTAGTCATTTAAAGAAGGAT pLKO.1 1824 3UTR 100% 3.000 2.100 N HYAL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07899 pDONR223 100% 99.8% 99.7% None 867C>T;1036G>T n/a
2 ccsbBroad304_07899 pLX_304 0% 99.8% 99.7% V5 867C>T;1036G>T n/a
3 TRCN0000476329 GAACCGATCGCACTTTGGTTACCG pLX_317 21.9% 99.8% 99.7% V5 867C>T;1036G>T n/a
Download CSV