Transcript: Human XM_017012142.2

PREDICTED: Homo sapiens ATP/GTP binding protein like 3 (AGBL3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGBL3 (340351)
Length:
4760
CDS:
1386..3941

Additional Resources:

NCBI RefSeq record:
XM_017012142.2
NBCI Gene record:
AGBL3 (340351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305105 ACGGGATTTAAACCGTAATTA pLKO_005 2642 CDS 100% 15.000 21.000 N Agbl3 n/a
2 TRCN0000422747 GACGGGATTTAAACCGTAATT pLKO_005 2641 CDS 100% 13.200 18.480 N AGBL3 n/a
3 TRCN0000073897 CCTGTGGATTACCGTGACAAT pLKO.1 1866 CDS 100% 4.950 6.930 N AGBL3 n/a
4 TRCN0000073894 CCCGGACTACACAGATACTAT pLKO.1 1537 CDS 100% 5.625 4.500 N AGBL3 n/a
5 TRCN0000428865 GATGGACAACCCACCTTATAT pLKO_005 4195 3UTR 100% 15.000 10.500 N AGBL3 n/a
6 TRCN0000073895 GCAACGAATCTTCCCACTTAT pLKO.1 2840 CDS 100% 13.200 9.240 N AGBL3 n/a
7 TRCN0000031420 GCAAGGTTTGAGAGTGGTAAT pLKO.1 1902 CDS 100% 10.800 7.560 N Agbl3 n/a
8 TRCN0000073896 CGTGACAATACTTTGATGTTT pLKO.1 1878 CDS 100% 5.625 3.938 N AGBL3 n/a
9 TRCN0000073893 CCAGATGATTATATGGTTGAT pLKO.1 3441 CDS 100% 4.950 3.465 N AGBL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13597 pDONR223 100% 72.6% 72.3% None (many diffs) n/a
2 ccsbBroad304_13597 pLX_304 0% 72.6% 72.3% V5 (many diffs) n/a
3 TRCN0000465400 CCCAGAGACAACCCGCAAACTTCG pLX_317 21.8% 72.6% 72.3% V5 (many diffs) n/a
Download CSV