Construct: ORF TRCN0000465400
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002851.1_s317c1
- Derived from:
- ccsbBroadEn_13597
- DNA Barcode:
- CCCAGAGACAACCCGCAAACTTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AGBL3 (340351)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465400
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012143.2 | 87.7% | 87.5% | (many diffs) |
2 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_011516122.3 | 80.5% | 80.5% | (many diffs) |
3 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012142.2 | 72.6% | 72.3% | (many diffs) |
4 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012140.2 | 71.9% | 71.7% | (many diffs) |
5 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012139.2 | 69.1% | 67.7% | (many diffs) |
6 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012138.2 | 67.2% | 67% | (many diffs) |
7 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_178563.4 | 67.1% | 66.9% | (many diffs) |
8 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012136.2 | 67.1% | 66.9% | (many diffs) |
9 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012137.2 | 67.1% | 66.9% | (many diffs) |
10 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NR_160300.1 | 62.4% | (many diffs) | |
11 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_017012141.2 | 60.4% | 60.2% | (many diffs) |
12 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XR_001744698.2 | 54.4% | (many diffs) | |
13 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XR_001744697.2 | 54.2% | (many diffs) | |
14 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XR_001744696.2 | 46.7% | (many diffs) | |
15 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XR_001744699.2 | 38.9% | (many diffs) | |
16 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001367812.1 | 23.4% | 18.1% | (many diffs) |
17 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001367813.1 | 23.4% | 18.1% | (many diffs) |
18 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001367816.1 | 17.4% | 16.4% | (many diffs) |
19 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001367817.1 | 17.4% | 16.4% | (many diffs) |
20 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001367818.1 | 17.4% | 16.4% | (many diffs) |
21 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001345852.1 | 15.9% | 13.2% | (many diffs) |
22 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001345853.1 | 15.9% | 13.2% | (many diffs) |
23 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | XM_024446750.1 | 15.9% | 13.2% | (many diffs) |
24 | human | 340351 | AGBL3 | ATP/GTP binding protein like 3 | NM_001367814.1 | 15.8% | 13.3% | (many diffs) |
25 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | XM_006506734.3 | 83.9% | 84.7% | (many diffs) |
26 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | XR_377501.3 | 61.5% | (many diffs) | |
27 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | NM_178630.4 | 54% | 54.1% | (many diffs) |
28 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | NM_001289656.1 | 53.7% | 53.9% | (many diffs) |
29 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | XM_006506731.3 | 52.8% | 52.8% | (many diffs) |
30 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | XR_377500.3 | 34.8% | (many diffs) | |
31 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | NM_001289657.1 | 33.2% | 33.7% | (many diffs) |
32 | mouse | 76223 | Agbl3 | ATP/GTP binding protein-like 3 | XM_011241501.1 | 33.2% | 33.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1929
- ORF length:
- 1863
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc agaagattca gaaaaggaag actattcaga cagaacaatc agtgatgaag 121 atgaatcgga tgaggatatg ttcatgaaat ttgtaagtga agatcttcat cggtgtgcac 181 ttttaacagc tgactctttt ggtgatccct tcttcccccg gactacacag atactattag 241 aatatcagct agggagatgg gtgccacgtc ttcgtgaacc aagggattta tatggtgtct 301 cttcttctgg tccattgagc ccaacacggt ggccatacca ttgtgaagtc atcgatgaaa 361 aagtccagca tattgattgg actccttctt gtcctgagcc agtgtatatc ccaacgggct 421 tagaaacgca acccctttat ccagactcca aggaagctac tgtggtttat ctagctgaag 481 atgcttacaa agagccctgt tttgtgtatt cccgagttgg gggtaaccga acacctttga 541 agcagcctgt ggattaccgt gacaatactt tgatgtttga agcaaggttt gagagtggta 601 atctacagaa ggtagtcaaa gtggcagaat acgaatacca attgactgta cgccctgacc 661 tcttcacaaa taaacacacc cagtggtact atttccaagt cactaatatg cgagcaggaa 721 tagtctacag attcactatt gtcaacttca ccaaacctgc tagtctttac agtcggggta 781 tgcgcccact gttctattct gaaaaagagg ccaaggctca tcacattggc tggcagagaa 841 taggagacca aatcaagtat tataggaaca acccaggcca agatgggcgc cattatttct 901 ctcttacatg gacatttcaa tttccacaca acaaagatac ctgctacttt gctcattgct 961 atccatacac ttacaccaac ctgcaagaat acctttctgg catcaataat gatccagtac 1021 ggtcaaagtt ttgtaaaata cgtgttttgt gccacacgct tgctaggaac atggtgtata 1081 ttttaacaat cactaccccc ttgaagaact ctgactcaag aaagcggaag gctgtgattc 1141 tgactgcaag ggtccatcca ggggaaacca acagctcttg gatcatgaaa ggcttcctag 1201 attatatttt aggaaactca agtgatgcac agttgcttcg ggacactttt gtcttcaagg 1261 tggtacccat gctgaatcca gatggtgtga ttgtgggaaa ttatcgctgt tccttagctg 1321 gacgggattt aaaccgtaat tatacatctc tcctgaagga atcttttcct tctgtatggt 1381 atacccggaa catggttcat agactgatgg agaaacgaga ggttatatta tactgtgatc 1441 ttcatggcca tagtaggaaa gagaacatct tcatgtatgg ctgtgatggt agtgacagat 1501 ctaagacatt atacttacag caacgaaTCT TCCCACTTAT GCTAAGCAAA AATTGTCCAG 1561 ATAAATTTTC ATTCTCAGCT TGCAAGTTTA ATGTCCAGAA GAGCAAAGAA GGAACAGGAA 1621 GGGTGGTAAT GTGGAAAATG GGAATCAGGA ACAGCTTTAC CATGGAGGCC ACCTTCTGTG 1681 GATCTACTCT GGGTAACAAA CGAGGCACTC ATTTCAGCAC GAAAGACCTG GAATCAATGG 1741 GATATCATTT TTGTGATTCT CTCTTGGATT ATTGTGATCC CGACCGGACC AAGTATTATC 1801 GGTGCCTGAA AGAATTAGAA GAAATGGAAA GACATATAAC CCTGGAAAAA GTCTTTGAGG 1861 ATTCAGACAC ACCTGTGATA GACATTACAT TGGATGTAGA GTCTAGAGAA CTGACATTTT 1921 TATTGAGATG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1981 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 2041 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACCCAGA GACAACCCGC AAACTTCGAC 2101 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt