Transcript: Human XM_017012156.1

PREDICTED: Homo sapiens CASTOR family member 3 (CASTOR3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASTOR3 (352954)
Length:
1106
CDS:
170..748

Additional Resources:

NCBI RefSeq record:
XM_017012156.1
NBCI Gene record:
CASTOR3 (352954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104157 GCACAGAAATGGCATCAAGAA pLKO.1 910 3UTR 100% 4.950 2.970 N Rpl29 n/a
2 TRCN0000334949 GCACAGAAATGGCATCAAGAA pLKO_005 910 3UTR 100% 4.950 2.970 N Rpl29 n/a
3 TRCN0000352396 CACTGGCTGACCAGAACATAT pLKO_005 519 CDS 100% 13.200 6.600 Y CASTOR2 n/a
4 TRCN0000337256 ACTGGCTGACCAGAACATATC pLKO_005 520 CDS 100% 10.800 5.400 Y CASTOR2 n/a
5 TRCN0000337255 CAGAGGATTACACTATCATTG pLKO_005 345 CDS 100% 10.800 5.400 Y CASTOR2 n/a
6 TRCN0000337254 TGTTCATGCTGTCCACGTATC pLKO_005 543 CDS 100% 6.000 3.000 Y CASTOR2 n/a
7 TRCN0000138621 CAAGACCAGGTGCAAGTTCTT pLKO.1 307 CDS 100% 4.950 2.475 Y CASTOR3 n/a
8 TRCN0000137329 GATCAAACTTGCCTTCCTGTT pLKO.1 283 CDS 100% 4.050 2.025 Y CASTOR3 n/a
9 TRCN0000138745 CAGGTGCAAGTTCTTCAGTCT pLKO.1 313 CDS 100% 2.640 1.320 Y CASTOR3 n/a
10 TRCN0000136784 CCAGAACATATCCGTGTTCAT pLKO.1 529 CDS 100% 0.495 0.248 Y CASTOR3 n/a
11 TRCN0000104155 GCCAAGAAGCACAACAAGAAA pLKO.1 997 3UTR 100% 5.625 3.375 N Rpl29 n/a
12 TRCN0000334951 GCCAAGAAGCACAACAAGAAA pLKO_005 997 3UTR 100% 5.625 3.375 N Rpl29 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1059 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000072987 CCTAAAGAAGATGCAGGCCAA pLKO.1 1020 3UTR 100% 2.160 1.080 Y RPL29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13623 pDONR223 100% 79.8% 72.3% None (many diffs) n/a
2 ccsbBroad304_13623 pLX_304 0% 79.8% 72.3% V5 (many diffs) n/a
3 TRCN0000477107 CCCCAGACCGATGGGTCGTTCCAT pLX_317 67.1% 79.8% 72.3% V5 (many diffs) n/a
Download CSV