Transcript: Human XM_017012332.2

PREDICTED: Homo sapiens ADAM metallopeptidase domain 22 (ADAM22), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM22 (53616)
Length:
6839
CDS:
216..3023

Additional Resources:

NCBI RefSeq record:
XM_017012332.2
NBCI Gene record:
ADAM22 (53616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012332.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232580 CTTCGTCGATATCCTCGTAAT pLKO_005 894 CDS 100% 10.800 15.120 N ADAM22 n/a
2 TRCN0000052260 GCAGCTTATATTGGTGGGATT pLKO.1 1239 CDS 100% 4.050 5.670 N ADAM22 n/a
3 TRCN0000232582 ATGGGAGACACTGGCTATTAT pLKO_005 1422 CDS 100% 15.000 10.500 N ADAM22 n/a
4 TRCN0000232581 CCCAGTCATTAGCCCATAATA pLKO_005 1327 CDS 100% 15.000 10.500 N ADAM22 n/a
5 TRCN0000232583 TTAGTGCTGGCCCTCATATTA pLKO_005 2454 CDS 100% 15.000 10.500 N ADAM22 n/a
6 TRCN0000052259 GCAGTAAAGAAGGCACTATTT pLKO.1 2257 CDS 100% 13.200 9.240 N ADAM22 n/a
7 TRCN0000257370 GCAGTAAAGAAGGCACTATTT pLKO_005 2257 CDS 100% 13.200 9.240 N ADAM22 n/a
8 TRCN0000052258 GCCCAGTCATTAGCCCATAAT pLKO.1 1326 CDS 100% 13.200 9.240 N ADAM22 n/a
9 TRCN0000052262 CCAGAGATAGACAATGCAAAT pLKO.1 1861 CDS 100% 10.800 7.560 N ADAM22 n/a
10 TRCN0000052261 CCCTGACTCATTTGTTGCATT pLKO.1 647 CDS 100% 4.950 3.465 N ADAM22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012332.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15859 pDONR223 0% 36.2% 35.1% None (many diffs) n/a
2 ccsbBroad304_15859 pLX_304 0% 36.2% 35.1% V5 (many diffs) n/a
3 TRCN0000473520 GGATTTATCCTGAAACACGATTGT pLX_317 40.8% 36.2% 35.1% V5 (many diffs) n/a
Download CSV