Transcript: Human XM_017012614.2

PREDICTED: Homo sapiens chromosome 7 open reading frame 26 (C7orf26), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C7orf26 (79034)
Length:
1890
CDS:
247..1686

Additional Resources:

NCBI RefSeq record:
XM_017012614.2
NBCI Gene record:
C7orf26 (79034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263638 ATTGCGGCCAATCTGCCAATA pLKO_005 592 CDS 100% 10.800 15.120 N C7orf26 n/a
2 TRCN0000282730 GCCTCTGTTCTCTGCGCATTT pLKO_005 1586 CDS 100% 10.800 15.120 N C7orf26 n/a
3 TRCN0000281591 ACCTATGGACTTGCTTGAAAT pLKO_005 510 CDS 100% 13.200 9.240 N C7orf26 n/a
4 TRCN0000282732 CAGACGCTGAAGCAGATATTC pLKO_005 409 CDS 100% 13.200 9.240 N C7orf26 n/a
5 TRCN0000172260 CTCCCACCTCTTGTACTCAAA pLKO.1 762 CDS 100% 4.950 3.465 N C7orf26 n/a
6 TRCN0000121030 GCACGAGAGATGACCTGAGAA pLKO.1 1016 CDS 100% 4.950 3.465 N E130309D02Rik n/a
7 TRCN0000340354 GCACGAGAGATGACCTGAGAA pLKO_005 1016 CDS 100% 4.950 3.465 N E130309D02Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12533 pDONR223 100% 45.7% 36.7% None (many diffs) n/a
2 ccsbBroad304_12533 pLX_304 0% 45.7% 36.7% V5 (many diffs) n/a
3 TRCN0000477172 AGACCTAATCGTTCAGTAAAGAAC pLX_317 27.1% 45.7% 36.7% V5 (many diffs) n/a
Download CSV