Transcript: Human XM_017012652.1

PREDICTED: Homo sapiens caldesmon 1 (CALD1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CALD1 (800)
Length:
4231
CDS:
241..1857

Additional Resources:

NCBI RefSeq record:
XM_017012652.1
NBCI Gene record:
CALD1 (800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157180 GCCGCATCAATGAATGGCTAA pLKO.1 1706 CDS 100% 4.050 5.670 N CALD1 n/a
2 TRCN0000330608 GCCGCATCAATGAATGGCTAA pLKO_005 1706 CDS 100% 4.050 5.670 N CALD1 n/a
3 TRCN0000330609 CTCAGTTGTAGAGGGCTAATT pLKO_005 1899 3UTR 100% 13.200 10.560 N CALD1 n/a
4 TRCN0000157319 CCAGAAGATGGCTTGTCAGAT pLKO.1 1342 CDS 100% 4.950 3.465 N CALD1 n/a
5 TRCN0000330607 CCAGAAGATGGCTTGTCAGAT pLKO_005 1342 CDS 100% 4.950 3.465 N CALD1 n/a
6 TRCN0000155691 CGCCAAGAAAGATACGAGATA pLKO.1 706 CDS 100% 4.950 3.465 N CALD1 n/a
7 TRCN0000330606 CGCCAAGAAAGATACGAGATA pLKO_005 706 CDS 100% 4.950 3.465 N CALD1 n/a
8 TRCN0000155194 GAAGAGTTCGAGAAGCTCAAA pLKO.1 1120 CDS 100% 4.950 3.465 N CALD1 n/a
9 TRCN0000155917 CATGGATCGAAAGAAGGGATT pLKO.1 918 CDS 100% 4.050 2.835 N CALD1 n/a
10 TRCN0000157861 CGAAGCAGAAAGAATCGCCTA pLKO.1 300 CDS 100% 2.160 1.512 N CALD1 n/a
11 TRCN0000108680 GCCTGTTTCTAAAGAAACCAT pLKO.1 2068 3UTR 100% 0.300 0.210 N Cald1 n/a
12 TRCN0000303123 GCCTGTTTCTAAAGAAACCAT pLKO_005 2068 3UTR 100% 0.300 0.210 N Cald1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00206 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00206 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469974 CCGTTCGTCACCGTGCTACGTCCA pLX_317 29% 100% 100% V5 n/a
Download CSV