Transcript: Human XM_017012672.2

PREDICTED: Homo sapiens CCM2 scaffold protein (CCM2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCM2 (83605)
Length:
2687
CDS:
699..1481

Additional Resources:

NCBI RefSeq record:
XM_017012672.2
NBCI Gene record:
CCM2 (83605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426921 CCAGGTCTTCCAGGTTGTTTA pLKO_005 1229 CDS 100% 13.200 9.240 N CCM2 n/a
2 TRCN0000083235 GCATTTCATAGACAATGCAAA pLKO.1 854 CDS 100% 0.495 0.347 N CCM2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1631 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04281 pDONR223 100% 51.6% 41.1% None (many diffs) n/a
2 ccsbBroad304_04281 pLX_304 0% 51.6% 41.1% V5 (many diffs) n/a
3 TRCN0000469977 AAGTACGCAATTACATCCAACGAA pLX_317 25.2% 51.6% 41.1% V5 (many diffs) n/a
Download CSV