Transcript: Human XM_017012678.1

PREDICTED: Homo sapiens calneuron 1 (CALN1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CALN1 (83698)
Length:
9573
CDS:
630..1289

Additional Resources:

NCBI RefSeq record:
XM_017012678.1
NBCI Gene record:
CALN1 (83698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012678.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427028 ACGATGGAACCGTTCAGTAAA pLKO_005 1402 3UTR 100% 13.200 9.240 N CALN1 n/a
2 TRCN0000447214 GACACGGACCTATGGACTATG pLKO_005 1370 3UTR 100% 10.800 7.560 N CALN1 n/a
3 TRCN0000056351 CAGAGTTTGAAGGAGTGCATT pLKO.1 1147 CDS 100% 4.950 3.465 N CALN1 n/a
4 TRCN0000056349 CAGTTTGACATGCAAAGGATA pLKO.1 1002 CDS 100% 4.950 3.465 N CALN1 n/a
5 TRCN0000056352 GAGTTGAAGCACATTCTCTAT pLKO.1 1032 CDS 100% 4.950 3.465 N CALN1 n/a
6 TRCN0000056348 CCACCTAACGATGAAGGACAT pLKO.1 1067 CDS 100% 4.050 2.835 N CALN1 n/a
7 TRCN0000056350 CCCAAACTGGTGTCTTCAGAA pLKO.1 936 CDS 100% 4.950 2.970 N CALN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012678.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09107 pDONR223 100% 99.8% 100% None 15T>C n/a
2 ccsbBroad304_09107 pLX_304 0% 99.8% 100% V5 15T>C n/a
3 TRCN0000468006 AAACCTCACGATCATTTTAAGGGT pLX_317 57.9% 99.8% 100% V5 15T>C n/a
Download CSV