Transcript: Human XM_017012732.1

PREDICTED: Homo sapiens trinucleotide repeat containing 18 (TNRC18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNRC18 (84629)
Length:
10296
CDS:
173..8980

Additional Resources:

NCBI RefSeq record:
XM_017012732.1
NBCI Gene record:
TNRC18 (84629)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247589 TGTCGCTGAGTAACGTCAAAG pLKO_005 2304 CDS 100% 10.800 15.120 N TNRC18 n/a
2 TRCN0000247593 TCGGCCATGCAGAGCCTTATA pLKO_005 1919 CDS 100% 13.200 10.560 N TNRC18 n/a
3 TRCN0000247591 CTGACGTGCAGAATATTATTT pLKO_005 9883 3UTR 100% 15.000 10.500 N TNRC18 n/a
4 TRCN0000247592 GACTTCATCAGTCAGCTAAAG pLKO_005 4859 CDS 100% 10.800 7.560 N TNRC18 n/a
5 TRCN0000122405 GCAGATGCTGAAGACCAAGAA pLKO.1 8863 CDS 100% 4.950 3.465 N LOC402508 n/a
6 TRCN0000122598 CGCAGCCGGAAGACCAGCAAA pLKO.1 6980 CDS 100% 0.000 0.000 N LOC402508 n/a
7 TRCN0000247590 AGAAGGAGGAGCGGATGTATG pLKO_005 4551 CDS 100% 10.800 5.400 Y TNRC18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.