Transcript: Human XM_017012858.2

PREDICTED: Homo sapiens septin 7 (SEPTIN7), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN7 (989)
Length:
2413
CDS:
176..1399

Additional Resources:

NCBI RefSeq record:
XM_017012858.2
NBCI Gene record:
SEPTIN7 (989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012858.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322633 GGGAAGCTCAACAACGTATTT pLKO_005 1317 CDS 100% 13.200 18.480 N SEPTIN7 n/a
2 TRCN0000322561 GAGGATAAATTGCCATAATAT pLKO_005 1758 3UTR 100% 15.000 10.500 N SEPTIN7 n/a
3 TRCN0000146634 CCAATCTCCCAAATCAAGTAT pLKO.1 92 5UTR 100% 5.625 3.938 N SEPTIN7 n/a
4 TRCN0000322631 CCAATCTCCCAAATCAAGTAT pLKO_005 92 5UTR 100% 5.625 3.938 N SEPTIN7 n/a
5 TRCN0000148338 CAGCACAAAGAATTGGAGGAA pLKO.1 1262 CDS 100% 2.640 1.848 N SEPTIN7 n/a
6 TRCN0000147893 GAACAAGAAGAAAGGGAAGAT pLKO.1 1372 CDS 100% 4.950 2.970 N SEPTIN7 n/a
7 TRCN0000350663 GAACAAGAAGAAAGGGAAGAT pLKO_005 1372 CDS 100% 4.950 2.970 N SEPTIN7 n/a
8 TRCN0000180810 GCAGCCTGTTATCGACTACAT pLKO.1 466 CDS 100% 4.950 2.970 N SEPTIN7 n/a
9 TRCN0000101848 CCTTCAGGACATGGACTTAAA pLKO.1 584 CDS 100% 13.200 6.600 Y Sept7 n/a
10 TRCN0000349184 CCTTCAGGACATGGACTTAAA pLKO_005 584 CDS 100% 13.200 6.600 Y Sept7 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 231 CDS 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000101849 CCAGAGGAATGCCAACAGTTT pLKO.1 686 CDS 100% 4.950 2.475 Y Sept7 n/a
13 TRCN0000316367 CCAGAGGAATGCCAACAGTTT pLKO_005 686 CDS 100% 4.950 2.475 Y Sept7 n/a
14 TRCN0000101846 GCAGTGTTGTTTATACTTCAT pLKO.1 559 CDS 100% 4.950 2.475 Y Sept7 n/a
15 TRCN0000316368 GCAGTGTTGTTTATACTTCAT pLKO_005 559 CDS 100% 4.950 2.475 Y Sept7 n/a
16 TRCN0000147835 GAGTTTATGAAGCGTTTGCAT pLKO.1 617 CDS 100% 3.000 1.500 Y SEPTIN7 n/a
17 TRCN0000322632 GAGTTTATGAAGCGTTTGCAT pLKO_005 617 CDS 100% 3.000 1.500 Y SEPTIN7 n/a
18 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 231 CDS 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012858.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10722 pDONR223 100% 93.1% 90.8% None (many diffs) n/a
2 ccsbBroad304_10722 pLX_304 0% 93.1% 90.8% V5 (many diffs) n/a
3 TRCN0000468514 CATTGAAAAGGAATCTTACTCCCC pLX_317 24.9% 93.1% 90.8% V5 (many diffs) n/a
Download CSV