Transcript: Human XM_017013232.1

PREDICTED: Homo sapiens fibrinogen like 1 (FGL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGL1 (2267)
Length:
2237
CDS:
1087..2025

Additional Resources:

NCBI RefSeq record:
XM_017013232.1
NBCI Gene record:
FGL1 (2267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151181 GAAGTCCAGTTCCTTGATAAA pLKO.1 1261 CDS 100% 13.200 18.480 N FGL1 n/a
2 TRCN0000319090 GAAGTCCAGTTCCTTGATAAA pLKO_005 1261 CDS 100% 13.200 18.480 N FGL1 n/a
3 TRCN0000150808 GCCGTTATGCACAATATAAGA pLKO.1 1634 CDS 100% 5.625 7.875 N FGL1 n/a
4 TRCN0000156822 GTGGGCTAGTCACCAAAGAAT pLKO.1 1761 CDS 100% 5.625 4.500 N FGL1 n/a
5 TRCN0000151020 GACAGAGATCATGACAACTAT pLKO.1 1798 CDS 100% 5.625 3.938 N FGL1 n/a
6 TRCN0000151295 GCTAGTCACCAAAGAATGAAA pLKO.1 1765 CDS 100% 5.625 3.938 N FGL1 n/a
7 TRCN0000319020 GCTAGTCACCAAAGAATGAAA pLKO_005 1765 CDS 100% 5.625 3.938 N FGL1 n/a
8 TRCN0000150328 CCTTGATAAAGGAGATGAGAA pLKO.1 1272 CDS 100% 4.950 3.465 N FGL1 n/a
9 TRCN0000157414 GACGATCTGATGGCAGTGAAA pLKO.1 1460 CDS 100% 4.950 3.465 N FGL1 n/a
10 TRCN0000319091 GACGATCTGATGGCAGTGAAA pLKO_005 1460 CDS 100% 4.950 3.465 N FGL1 n/a
11 TRCN0000089520 GTATGCAGATTGTTCAGAGAT pLKO.1 1323 CDS 100% 4.950 3.465 N Fgl1 n/a
12 TRCN0000325609 GTATGCAGATTGTTCAGAGAT pLKO_005 1323 CDS 100% 4.950 3.465 N Fgl1 n/a
13 TRCN0000153532 CTGAACATATCCATGCGCAAT pLKO.1 2092 3UTR 100% 4.050 2.835 N FGL1 n/a
14 TRCN0000319021 CTGAACATATCCATGCGCAAT pLKO_005 2092 3UTR 100% 4.050 2.835 N FGL1 n/a
15 TRCN0000152965 GAGAATGAAGTCCAGTTCCTT pLKO.1 1255 CDS 100% 3.000 2.100 N FGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06212 pDONR223 100% 99.8% 100% None 42G>T n/a
2 ccsbBroad304_06212 pLX_304 0% 99.8% 100% V5 42G>T n/a
3 TRCN0000467977 GACATCATACTCCAATGCCCTACG pLX_317 38.4% 99.8% 100% V5 42G>T n/a
Download CSV