Transcript: Human XM_017013413.1

PREDICTED: Homo sapiens lymphocyte antigen 6 family member H (LY6H), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LY6H (4062)
Length:
937
CDS:
103..603

Additional Resources:

NCBI RefSeq record:
XM_017013413.1
NBCI Gene record:
LY6H (4062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063954 GACTTCGTTAAGCGACACTTT pLKO.1 412 CDS 100% 4.950 6.930 N LY6H n/a
2 TRCN0000446046 TGTGTGCCAGTGTCCGAATCA pLKO_005 332 CDS 100% 4.950 6.930 N LY6H n/a
3 TRCN0000427794 TGGGATCTTAAAGGTCGACGT pLKO_005 465 CDS 100% 2.160 3.024 N LY6H n/a
4 TRCN0000436871 AGTGTCCGAATCACCGATCCC pLKO_005 340 CDS 100% 0.720 1.008 N LY6H n/a
5 TRCN0000063955 GAAGGATCACTCGGTGAACAA pLKO.1 372 CDS 100% 4.950 3.465 N LY6H n/a
6 TRCN0000063956 TGCGAGAAGGATTTGTGCAAT pLKO.1 493 CDS 100% 4.950 3.465 N LY6H n/a
7 TRCN0000063953 GCAGCTGGACATCTCCAGGAA pLKO.1 785 3UTR 100% 0.088 0.062 N LY6H n/a
8 TRCN0000099844 CGACGTGGACTGCTGCGAGAA pLKO.1 480 CDS 100% 0.000 0.000 N Ly6h n/a
9 TRCN0000063957 GTTTATTAACTCTGGGATCTT pLKO.1 453 CDS 100% 4.950 2.970 N LY6H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06544 pDONR223 100% 83.7% 84.3% None (many diffs) n/a
2 ccsbBroad304_06544 pLX_304 0% 83.7% 84.3% V5 (many diffs) n/a
3 TRCN0000466996 AACTTACCAGCTTGCCCCCCGTCA pLX_317 90.6% 83.7% 84.3% V5 (many diffs) n/a
Download CSV