Transcript: Human XM_017013535.1

PREDICTED: Homo sapiens scavenger receptor class A member 3 (SCARA3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCARA3 (51435)
Length:
3676
CDS:
189..2009

Additional Resources:

NCBI RefSeq record:
XM_017013535.1
NBCI Gene record:
SCARA3 (51435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322969 GCATGGCTTCTCACGAGATTG pLKO_005 1234 CDS 100% 10.800 15.120 N SCARA3 n/a
2 TRCN0000063456 CAAAGGAGATATGGGCGTGAA pLKO.1 1589 CDS 100% 4.050 5.670 N SCARA3 n/a
3 TRCN0000063454 CGAGATTGAAATTGGCACCAT pLKO.1 1247 CDS 100% 2.640 3.696 N SCARA3 n/a
4 TRCN0000323047 ACAGCTGTGGTCCTCTGATTC pLKO_005 2093 3UTR 100% 10.800 8.640 N SCARA3 n/a
5 TRCN0000375229 TGCCAGAAGAACCTATCTTTG pLKO_005 321 CDS 100% 10.800 8.640 N Scara3 n/a
6 TRCN0000063453 CCAGTCTATTTATGACAAGAA pLKO.1 458 CDS 100% 4.950 3.960 N SCARA3 n/a
7 TRCN0000063455 GCTGCCAGAAGAACCTATCTT pLKO.1 319 CDS 100% 5.625 3.938 N SCARA3 n/a
8 TRCN0000300916 GCTGCCAGAAGAACCTATCTT pLKO_005 319 CDS 100% 5.625 3.938 N SCARA3 n/a
9 TRCN0000063457 CTTCGCAATGTCACCATCCTA pLKO.1 1533 CDS 100% 3.000 2.100 N SCARA3 n/a
10 TRCN0000331703 CTTCGCAATGTCACCATCCTA pLKO_005 1533 CDS 100% 3.000 2.100 N SCARA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03306 pDONR223 100% 75.8% 74.3% None (many diffs) n/a
2 ccsbBroad304_03306 pLX_304 0% 75.8% 74.3% V5 (many diffs) n/a
Download CSV