Transcript: Human XM_017013618.1

PREDICTED: Homo sapiens integrator complex subunit 8 (INTS8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INTS8 (55656)
Length:
7519
CDS:
287..2683

Additional Resources:

NCBI RefSeq record:
XM_017013618.1
NBCI Gene record:
INTS8 (55656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139073 CACAATGTTCGGGAGGACATT pLKO.1 2036 CDS 100% 0.495 0.693 N INTS8 n/a
2 TRCN0000121938 CCTCAGAGAAATTGACTACAA pLKO.1 2404 CDS 100% 4.950 3.465 N INTS8 n/a
3 TRCN0000144908 GAAGAACGAAAGCTACTTGTT pLKO.1 1109 CDS 100% 4.950 3.465 N INTS8 n/a
4 TRCN0000145179 GATGAAGAACGAAAGCTACTT pLKO.1 1106 CDS 100% 4.950 3.465 N INTS8 n/a
5 TRCN0000143341 GCAGCTACATGCAAAGAACTT pLKO.1 1787 CDS 100% 4.950 3.465 N INTS8 n/a
6 TRCN0000143028 CTTTGCTGCTTGTTTGGAGTT pLKO.1 1471 CDS 100% 4.050 2.835 N INTS8 n/a
7 TRCN0000143876 CCCTGATGTTTATACAGACCA pLKO.1 2311 CDS 100% 2.640 1.848 N INTS8 n/a
8 TRCN0000122173 GATGTTTATACAGACCAGGTA pLKO.1 2315 CDS 100% 2.640 1.848 N INTS8 n/a
9 TRCN0000143466 GCAATCACAGTGAAAGAGCTA pLKO.1 2138 CDS 100% 2.640 1.848 N INTS8 n/a
10 TRCN0000122063 CCCTAGAGTAAATCTGTGCAT pLKO.1 1150 CDS 100% 2.640 1.584 N INTS8 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5462 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5463 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.