Transcript: Human XM_017013869.2

PREDICTED: Homo sapiens RAB11 family interacting protein 1 (RAB11FIP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB11FIP1 (80223)
Length:
3584
CDS:
57..3584

Additional Resources:

NCBI RefSeq record:
XM_017013869.2
NBCI Gene record:
RAB11FIP1 (80223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013869.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122490 CCGCTCTAATGTCTGCATCAA pLKO.1 995 CDS 100% 4.950 6.930 N RAB11FIP1 n/a
2 TRCN0000144803 GATGATGAGTCTGTGGTTAAA pLKO.1 663 CDS 100% 13.200 9.240 N RAB11FIP1 n/a
3 TRCN0000145281 GAAATCCAAACCAGGAAAGAA pLKO.1 440 CDS 100% 5.625 3.938 N RAB11FIP1 n/a
4 TRCN0000352860 GAAATCCAAACCAGGAAAGAA pLKO_005 440 CDS 100% 5.625 3.938 N RAB11FIP1 n/a
5 TRCN0000141878 GCAACTGAACCAGGTCAACTT pLKO.1 908 CDS 100% 4.950 3.465 N RAB11FIP1 n/a
6 TRCN0000343418 GCAACTGAACCAGGTCAACTT pLKO_005 908 CDS 100% 4.950 3.465 N RAB11FIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013869.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04193 pDONR223 100% 51.8% 47.2% None (many diffs) n/a
2 ccsbBroad304_04193 pLX_304 0% 51.8% 47.2% V5 (many diffs) n/a
3 TRCN0000477132 GGGAGGCTATGTCTCGTGCAAGGT pLX_317 21% 51.8% 47.2% V5 (many diffs) n/a
Download CSV