Transcript: Human XM_017013881.1

PREDICTED: Homo sapiens ring finger protein 170 (RNF170), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF170 (81790)
Length:
3811
CDS:
175..951

Additional Resources:

NCBI RefSeq record:
XM_017013881.1
NBCI Gene record:
RNF170 (81790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033976 GCTTTGATTGCTACCCTGGTA pLKO.1 277 CDS 100% 2.640 3.696 N RNF170 n/a
2 TRCN0000231907 AGATTGCATCAGGATATTAAT pLKO_005 625 CDS 100% 15.000 10.500 N RNF170 n/a
3 TRCN0000231908 AGGGCAACCCAGATCTATTAT pLKO_005 666 CDS 100% 15.000 10.500 N RNF170 n/a
4 TRCN0000231909 GCTTATCTACATCTCTATTAT pLKO_005 894 CDS 100% 15.000 10.500 N RNF170 n/a
5 TRCN0000231910 TCATACTTCGATATCATATTC pLKO_005 1529 3UTR 100% 13.200 9.240 N RNF170 n/a
6 TRCN0000231906 TGATTGCTACCCTGGTATATG pLKO_005 281 CDS 100% 13.200 9.240 N RNF170 n/a
7 TRCN0000033975 ACTTTGTTTAATGGGAGCTTT pLKO.1 783 CDS 100% 4.950 3.465 N RNF170 n/a
8 TRCN0000033974 CAGTTTATCCATCTTATCCTT pLKO.1 1303 3UTR 100% 3.000 2.100 N RNF170 n/a
9 TRCN0000033977 CTACCCACTTTACTGAGGCAT pLKO.1 703 CDS 100% 2.640 1.848 N RNF170 n/a
10 TRCN0000033978 GAAGTGATAACCCAAAGGCTA pLKO.1 922 CDS 100% 2.640 1.848 N RNF170 n/a
11 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 1619 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10260 pDONR223 100% 44.9% 42% None 322_395del;423_774del n/a
2 ccsbBroad304_10260 pLX_304 0% 44.9% 42% V5 322_395del;423_774del n/a
3 TRCN0000480084 CGCACCAGATAGGTTAACGTGATC pLX_317 100% 44.9% 42% V5 322_395del;423_774del n/a
Download CSV