Transcript: Human XM_017014010.2

PREDICTED: Homo sapiens regulating synaptic membrane exocytosis 2 (RIMS2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIMS2 (9699)
Length:
8126
CDS:
644..5521

Additional Resources:

NCBI RefSeq record:
XM_017014010.2
NBCI Gene record:
RIMS2 (9699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380020 CAAGGTTGGTCACCAATTAAT pLKO_005 3079 CDS 100% 15.000 21.000 N RIMS2 n/a
2 TRCN0000380497 TATACCGCGAATACCTGATAG pLKO_005 2857 CDS 100% 10.800 15.120 N RIMS2 n/a
3 TRCN0000106159 GCTGATACTGTAGGACATCTT pLKO.1 2702 CDS 100% 4.950 6.930 N Rims2 n/a
4 TRCN0000001326 GCTACCGAAGTGATCCGAATT pLKO.1 1812 CDS 100% 0.000 0.000 N RIMS2 n/a
5 TRCN0000381485 TACGGAAACAGCACCACTTAG pLKO_005 2178 CDS 100% 10.800 8.640 N RIMS2 n/a
6 TRCN0000001329 CCACGCCTGAATATACAAGTT pLKO.1 2379 CDS 100% 4.950 3.960 N RIMS2 n/a
7 TRCN0000382475 TAAAGATGGAGATCGTTTAAT pLKO_005 2533 CDS 100% 15.000 10.500 N RIMS2 n/a
8 TRCN0000001325 CCACCACCAAAGCCTCATAAA pLKO.1 2297 CDS 100% 13.200 9.240 N RIMS2 n/a
9 TRCN0000381267 TATGAAGACTCTGATCATTTA pLKO_005 1670 CDS 100% 13.200 9.240 N RIMS2 n/a
10 TRCN0000001327 CCAGGTGATGAAGTATTAGAA pLKO.1 2726 CDS 100% 5.625 3.938 N RIMS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07470 pDONR223 100% 67.6% 60.1% None (many diffs) n/a
2 ccsbBroad304_07470 pLX_304 0% 67.6% 60.1% V5 (many diffs) n/a
3 TRCN0000473307 TTTTCTTAGGCCTTTTTCGTTTAA pLX_317 13.5% 67.6% 60.1% V5 (many diffs) n/a
Download CSV