Transcript: Human XM_017014339.1

PREDICTED: Homo sapiens zinc finger protein 483 (ZNF483), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF483 (158399)
Length:
1283
CDS:
233..967

Additional Resources:

NCBI RefSeq record:
XM_017014339.1
NBCI Gene record:
ZNF483 (158399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017493 CCAGCTAAAGTGGGTTGAATT pLKO.1 892 CDS 100% 0.000 0.000 N ZNF483 n/a
2 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1010 3UTR 100% 13.200 6.600 Y LIAS n/a
3 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1175 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13305 pDONR223 100% 100% 100% None n/a
2 TRCN0000471195 ACTAATGTCAGATACCACCTCCTC pLX_317 33.5% 100% 100% V5 n/a
Download CSV