Transcript: Human XM_017014430.1

PREDICTED: Homo sapiens transmembrane protein 268 (TMEM268), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM268 (203197)
Length:
4447
CDS:
484..1338

Additional Resources:

NCBI RefSeq record:
XM_017014430.1
NBCI Gene record:
TMEM268 (203197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128942 CTACTCTACCAGTCAGATGTT pLKO.1 774 CDS 100% 4.950 3.465 N TMEM268 n/a
2 TRCN0000297140 CTACTCTACCAGTCAGATGTT pLKO_005 774 CDS 100% 4.950 3.465 N TMEM268 n/a
3 TRCN0000129606 CGGATTGACAATACCTGTGCA pLKO.1 559 CDS 100% 2.640 1.848 N TMEM268 n/a
4 TRCN0000278254 CGGATTGACAATACCTGTGCA pLKO_005 559 CDS 100% 2.640 1.848 N TMEM268 n/a
5 TRCN0000128888 GCAATTCTTGTCCTAACGAGA pLKO.1 1085 CDS 100% 2.640 1.848 N TMEM268 n/a
6 TRCN0000297426 GCAATTCTTGTCCTAACGAGA pLKO_005 1085 CDS 100% 2.640 1.848 N TMEM268 n/a
7 TRCN0000130261 CCAAGACCAAACGCATCTAAA pLKO.1 2236 3UTR 100% 13.200 7.920 N TMEM268 n/a
8 TRCN0000278255 CCAAGACCAAACGCATCTAAA pLKO_005 2236 3UTR 100% 13.200 7.920 N TMEM268 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3080 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2946 3UTR 100% 2.640 1.320 Y LINC01098 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3080 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014430.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13399 pDONR223 100% 88.4% 88.4% None 409_410ins111 n/a
2 ccsbBroad304_13399 pLX_304 0% 88.4% 88.4% V5 409_410ins111 n/a
3 TRCN0000479222 TCAAGCATTTAAGTTGAAATTCCT pLX_317 51.4% 88.4% 88.4% V5 409_410ins111 n/a
Download CSV