Transcript: Human XM_017014551.1

PREDICTED: Homo sapiens BICD cargo adaptor 2 (BICD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BICD2 (23299)
Length:
4746
CDS:
98..2653

Additional Resources:

NCBI RefSeq record:
XM_017014551.1
NBCI Gene record:
BICD2 (23299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217388 GCCAAATTGTGGTACACTTAG pLKO.1 3580 3UTR 100% 10.800 15.120 N Bicd2 n/a
2 TRCN0000315158 ATGACATCAAGGAGTACAAAT pLKO_005 672 CDS 100% 13.200 9.240 N BICD2 n/a
3 TRCN0000005273 CCAGGTGTGACGAGTACATTA pLKO.1 2433 CDS 100% 13.200 9.240 N BICD2 n/a
4 TRCN0000315157 CCAGGTGTGACGAGTACATTA pLKO_005 2433 CDS 100% 13.200 9.240 N BICD2 n/a
5 TRCN0000005271 GCCAACCTGAAGAGCAAGTAT pLKO.1 2303 CDS 100% 5.625 3.938 N BICD2 n/a
6 TRCN0000184329 GCCAACCTGAAGAGCAAGTAT pLKO.1 2303 CDS 100% 5.625 3.938 N Bicd2 n/a
7 TRCN0000315156 GCCAACCTGAAGAGCAAGTAT pLKO_005 2303 CDS 100% 5.625 3.938 N BICD2 n/a
8 TRCN0000005270 CCTTTGGACAAGCACACACAA pLKO.1 420 CDS 100% 4.950 3.465 N BICD2 n/a
9 TRCN0000005272 GCTGTCACACTACATGAGCAT pLKO.1 958 CDS 100% 2.640 1.848 N BICD2 n/a
10 TRCN0000315223 GCTGTCACACTACATGAGCAT pLKO_005 958 CDS 100% 2.640 1.848 N BICD2 n/a
11 TRCN0000250367 TGAGTAGTATTACCTACAAAT pLKO_005 3446 3UTR 100% 13.200 7.920 N Bicd2 n/a
12 TRCN0000005269 GCTGCCAGGAGGACTTGGCCA pLKO.1 2658 3UTR 100% 0.000 0.000 N BICD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02748 pDONR223 100% 93.4% 93.3% None 239_319del;2549_2550insCGTAAGTCACA;2553_2554ins82 n/a
2 ccsbBroad304_02748 pLX_304 0% 93.4% 93.3% V5 239_319del;2549_2550insCGTAAGTCACA;2553_2554ins82 n/a
3 TRCN0000475631 ACCCCTCTGCTATAGTTACCAGGT pLX_317 13.5% 93.4% 93.3% V5 239_319del;2549_2550insCGTAAGTCACA;2553_2554ins82 n/a
Download CSV