Transcript: Human XM_017014628.2

PREDICTED: Homo sapiens G protein subunit alpha q (GNAQ), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNAQ (2776)
Length:
3619
CDS:
118..1023

Additional Resources:

NCBI RefSeq record:
XM_017014628.2
NBCI Gene record:
GNAQ (2776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036759 CCTCGGTTATTCTGTTCTTAA pLKO.1 743 CDS 100% 13.200 9.240 N GNAQ n/a
2 TRCN0000333158 CCTCGGTTATTCTGTTCTTAA pLKO_005 743 CDS 100% 13.200 9.240 N GNAQ n/a
3 TRCN0000344650 CTATGATAGACGACGAGAATA pLKO_005 375 CDS 100% 13.200 9.240 N GNAQ n/a
4 TRCN0000036761 CCATACAAGTATGAGCACAAT pLKO.1 241 CDS 100% 4.950 3.465 N GNAQ n/a
5 TRCN0000036760 CCTGGAATCCAGGAATGCTAT pLKO.1 358 CDS 100% 4.950 3.465 N GNAQ n/a
6 TRCN0000036763 GCACAATTAGTTCGAGAAGTT pLKO.1 271 CDS 100% 4.950 3.465 N GNAQ n/a
7 TRCN0000333235 GCACAATTAGTTCGAGAAGTT pLKO_005 271 CDS 100% 4.950 3.465 N GNAQ n/a
8 TRCN0000036762 GACACCGAGAATATCCGCTTT pLKO.1 940 CDS 100% 4.050 2.835 N GNAQ n/a
9 TRCN0000333237 GACACCGAGAATATCCGCTTT pLKO_005 940 CDS 100% 4.050 2.835 N GNAQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00650 pDONR223 100% 64.8% 76% None (many diffs) n/a
2 ccsbBroad304_00650 pLX_304 0% 64.8% 76% V5 (many diffs) n/a
3 TRCN0000481250 AGCAATGTCGGCCTCTATCAGTAG pLX_317 35.8% 64.8% 76% V5 (many diffs) n/a
Download CSV