Transcript: Human XM_017014691.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 21 (ZDHHC21), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC21 (340481)
Length:
11686
CDS:
3081..3791

Additional Resources:

NCBI RefSeq record:
XM_017014691.1
NBCI Gene record:
ZDHHC21 (340481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142952 CCACTTTGCCAATCATGTCTA pLKO.1 3770 CDS 100% 4.950 6.930 N ZDHHC21 n/a
2 TRCN0000278259 CCACTTTGCCAATCATGTCTA pLKO_005 3770 CDS 100% 4.950 6.930 N ZDHHC21 n/a
3 TRCN0000139354 CCTCCATAACTGATCCAGGAA pLKO.1 3193 CDS 100% 2.640 3.696 N ZDHHC21 n/a
4 TRCN0000143565 GAAAGGGAGTTCTGGGAATTA pLKO.1 3246 CDS 100% 13.200 9.240 N ZDHHC21 n/a
5 TRCN0000278260 GAAAGGGAGTTCTGGGAATTA pLKO_005 3246 CDS 100% 13.200 9.240 N ZDHHC21 n/a
6 TRCN0000140807 GCAGCCTTTATGGGCATTACT pLKO.1 3540 CDS 100% 5.625 3.938 N ZDHHC21 n/a
7 TRCN0000144573 GCATCATCACAGATACAACAT pLKO.1 3604 CDS 100% 4.950 3.465 N ZDHHC21 n/a
8 TRCN0000144923 GTTGGAATAACTGGACTCTTT pLKO.1 3567 CDS 100% 4.950 3.465 N ZDHHC21 n/a
9 TRCN0000297428 GTTGGAATAACTGGACTCTTT pLKO_005 3567 CDS 100% 4.950 3.465 N ZDHHC21 n/a
10 TRCN0000143485 GAAGGACATATTCCAGGCATA pLKO.1 3117 CDS 100% 4.050 2.835 N ZDHHC21 n/a
11 TRCN0000278261 GAAGGACATATTCCAGGCATA pLKO_005 3117 CDS 100% 4.050 2.835 N ZDHHC21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014691.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10027 pDONR223 100% 88.9% 89% None 36_37ins87;231T>C n/a
Download CSV