Transcript: Human XM_017014800.1

PREDICTED: Homo sapiens proprotein convertase subtilisin/kexin type 5 (PCSK5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCSK5 (5125)
Length:
5439
CDS:
166..4518

Additional Resources:

NCBI RefSeq record:
XM_017014800.1
NBCI Gene record:
PCSK5 (5125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051179 CCAACCAATGAATTTCCGAAA pLKO.1 667 CDS 100% 4.050 5.670 N PCSK5 n/a
2 TRCN0000294470 ACTATGGCACAGAGGATTATG pLKO_005 731 CDS 100% 13.200 9.240 N PCSK5 n/a
3 TRCN0000051178 CCTGTGAAGATGGACGGTATT pLKO.1 1163 CDS 100% 10.800 7.560 N PCSK5 n/a
4 TRCN0000287083 CCTGTGAAGATGGACGGTATT pLKO_005 1163 CDS 100% 10.800 7.560 N PCSK5 n/a
5 TRCN0000051181 GCTATTACTTTGACCACTCTT pLKO.1 1316 CDS 100% 4.950 3.465 N PCSK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06697 pDONR223 100% 24.5% 23.5% None (many diffs) n/a
2 ccsbBroad304_06697 pLX_304 0% 24.5% 23.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468891 TGGTCCTTATAGGCAGCTTCCTAG pLX_317 .7% 24.5% 23.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV