Transcript: Human XM_017014849.1

PREDICTED: Homo sapiens AU RNA binding methylglutaconyl-CoA hydratase (AUH), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AUH (549)
Length:
1532
CDS:
36..1007

Additional Resources:

NCBI RefSeq record:
XM_017014849.1
NBCI Gene record:
AUH (549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052450 CCCTCGCTATAAAGGAGAATA pLKO.1 986 CDS 100% 13.200 18.480 N AUH n/a
2 TRCN0000303617 GCAATAGATGGACTCGCTTTA pLKO_005 567 CDS 100% 10.800 8.640 N AUH n/a
3 TRCN0000303619 AGAGCAGTGATTAACGATATT pLKO_005 519 CDS 100% 13.200 9.240 N AUH n/a
4 TRCN0000303616 AGATTATTCATACGGTGTAAT pLKO_005 1119 3UTR 100% 13.200 9.240 N AUH n/a
5 TRCN0000303618 AGTGAAGTCCCAGGGATATTC pLKO_005 426 CDS 100% 13.200 9.240 N AUH n/a
6 TRCN0000052452 GATAAGAAAGTACGGACCATA pLKO.1 396 CDS 100% 4.950 3.465 N AUH n/a
7 TRCN0000052449 GCTTGGAATAAACAGAGCTTA pLKO.1 308 CDS 100% 4.950 3.465 N AUH n/a
8 TRCN0000299346 GCTTGGAATAAACAGAGCTTA pLKO_005 308 CDS 100% 4.950 3.465 N AUH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10692 pDONR223 100% 86.7% 86.7% None 417_503del;892_893ins48 n/a
2 ccsbBroad304_10692 pLX_304 0% 86.7% 86.7% V5 417_503del;892_893ins48 n/a
3 TRCN0000481053 CAATGATTCCATAACCTCATAGTC pLX_317 32% 86.7% 86.7% V5 417_503del;892_893ins48 n/a
Download CSV