Transcript: Human XM_017015015.1

PREDICTED: Homo sapiens SET nuclear proto-oncogene (SET), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SET (6418)
Length:
3334
CDS:
132..1061

Additional Resources:

NCBI RefSeq record:
XM_017015015.1
NBCI Gene record:
SET (6418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063713 GCTGAAATTAAATGCCACTTT pLKO.1 3098 3UTR 100% 4.950 3.465 N SET n/a
2 TRCN0000063717 CCACCGAAATCAAATGGAAAT pLKO.1 634 CDS 100% 10.800 6.480 N SET n/a
3 TRCN0000288709 CCACCGAAATCAAATGGAAAT pLKO_005 634 CDS 100% 10.800 6.480 N SET n/a
4 TRCN0000077183 CCAACATGTATCTGTCTACTT pLKO.1 2050 3UTR 100% 4.950 2.970 N Set n/a
5 TRCN0000063715 CCAGAGTTGAAGTGACAGAAT pLKO.1 493 CDS 100% 4.950 2.970 N SET n/a
6 TRCN0000288673 CCAGAGTTGAAGTGACAGAAT pLKO_005 493 CDS 100% 4.950 2.970 N SET n/a
7 TRCN0000063716 GCGATTGAACACATTGATGAA pLKO.1 261 CDS 100% 4.950 2.970 N SET n/a
8 TRCN0000288611 GCGATTGAACACATTGATGAA pLKO_005 261 CDS 100% 4.950 2.970 N SET n/a
9 TRCN0000425634 ATCAGGTTACAGAATAGATTT pLKO_005 527 CDS 100% 13.200 6.600 Y Set n/a
10 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 867 CDS 100% 4.950 2.475 Y SET n/a
11 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 867 CDS 100% 4.950 2.475 Y SET n/a
12 TRCN0000077186 GAGAGCTTCTTTACCTGGTTT pLKO.1 729 CDS 100% 4.950 2.475 Y Set n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01519 pDONR223 100% 83.6% 82.2% None (many diffs) n/a
2 ccsbBroad304_01519 pLX_304 0% 83.6% 82.2% V5 (many diffs) n/a
3 TRCN0000474477 TCAGCCTACCATCAACTTCGTATT pLX_317 68% 83.6% 82.2% V5 (many diffs) n/a
Download CSV