Transcript: Human XM_017015330.2

PREDICTED: Homo sapiens mediator complex subunit 27 (MED27), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MED27 (9442)
Length:
1801
CDS:
23..913

Additional Resources:

NCBI RefSeq record:
XM_017015330.2
NBCI Gene record:
MED27 (9442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022025 CCGCTAATCAGATGGGAGTAT pLKO.1 429 CDS 100% 4.950 2.475 Y MED27 n/a
2 TRCN0000022027 CCTGAAATGTCCATCCACTTA pLKO.1 542 CDS 100% 4.950 2.475 Y MED27 n/a
3 TRCN0000330482 CCTGAAATGTCCATCCACTTA pLKO_005 542 CDS 100% 4.950 2.475 Y MED27 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1664 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 1690 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
6 TRCN0000022028 CCTCTCTATAGTCAACTCCTT pLKO.1 326 CDS 100% 2.640 1.320 Y MED27 n/a
7 TRCN0000022024 GCCTGTTCATTGATCGAACAA pLKO.1 639 CDS 100% 0.495 0.248 Y MED27 n/a
8 TRCN0000330483 GCCTGTTCATTGATCGAACAA pLKO_005 639 CDS 100% 0.495 0.248 Y MED27 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1665 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.