Transcript: Human XM_017015340.2

PREDICTED: Homo sapiens guanine deaminase (GDA), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GDA (9615)
Length:
2562
CDS:
237..1142

Additional Resources:

NCBI RefSeq record:
XM_017015340.2
NBCI Gene record:
GDA (9615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046993 CCATGCTTGATGCAATCAGAA pLKO.1 739 CDS 100% 4.950 6.930 N GDA n/a
2 TRCN0000046994 GCTTGTTACTTTGCAACAATT pLKO.1 141 5UTR 100% 1.320 1.848 N GDA n/a
3 TRCN0000046995 CGATCAAGGAAACTGAGAGAT pLKO.1 286 CDS 100% 4.950 3.465 N GDA n/a
4 TRCN0000046996 GTGATATTTCTGAGGCTGTTA pLKO.1 979 CDS 100% 4.950 2.970 N GDA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02211 pDONR223 100% 60.2% 60.2% None 0_1ins510;853_903del n/a
2 ccsbBroad304_02211 pLX_304 0% 60.2% 60.2% V5 0_1ins510;853_903del n/a
3 TRCN0000475326 AACGAAGATCTATTACCCAAATTC pLX_317 30.2% 60.2% 60.2% V5 0_1ins510;853_903del n/a
Download CSV