Transcript: Human XM_017015987.1

PREDICTED: Homo sapiens La ribonucleoprotein 4B (LARP4B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LARP4B (23185)
Length:
8072
CDS:
867..4688

Additional Resources:

NCBI RefSeq record:
XM_017015987.1
NBCI Gene record:
LARP4B (23185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121550 CAGGCTATCTAGCTTGATAAT pLKO.1 4022 CDS 100% 13.200 18.480 N LARP4B n/a
2 TRCN0000427508 CGAAGCAGGAATCCTAGTAAA pLKO_005 3591 CDS 100% 13.200 18.480 N LARP4B n/a
3 TRCN0000139604 CCAGCTCATTTACCCGATGAT pLKO.1 4170 CDS 100% 4.950 6.930 N LARP4B n/a
4 TRCN0000122023 GCATAGTAATATTGCGTGAAA pLKO.1 3073 CDS 100% 4.950 6.930 N LARP4B n/a
5 TRCN0000122708 CGAGTAAAGAGCCTCCTTCTT pLKO.1 4441 CDS 100% 4.950 3.960 N LARP4B n/a
6 TRCN0000421566 AGCAAAGGCAATAGCTATAAA pLKO_005 3293 CDS 100% 15.000 10.500 N LARP4B n/a
7 TRCN0000144706 GATTTGTCAGAGAACGAGTAA pLKO.1 4427 CDS 100% 4.950 3.465 N LARP4B n/a
8 TRCN0000424401 CTCTGAATGCAAGCTATATAT pLKO_005 5004 3UTR 100% 15.000 9.000 N LARP4B n/a
9 TRCN0000121637 GCACTAAAGTTAGCAAGTTTA pLKO.1 5766 3UTR 100% 13.200 7.920 N LARP4B n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 19 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 19 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02731 pDONR223 100% 56.5% 55.1% None (many diffs) n/a
2 ccsbBroad304_02731 pLX_304 0% 56.5% 55.1% V5 (many diffs) n/a
3 TRCN0000473978 GACTACGACTAAGTGGCATACCGC pLX_317 15.6% 56.5% 55.1% V5 (many diffs) n/a
Download CSV