Transcript: Human XM_017016028.2

PREDICTED: Homo sapiens proline and serine rich 2 (PROSER2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROSER2 (254427)
Length:
4322
CDS:
1144..2451

Additional Resources:

NCBI RefSeq record:
XM_017016028.2
NBCI Gene record:
PROSER2 (254427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421012 TCGAAGTACATGACATGAAAG pLKO_005 2828 3UTR 100% 10.800 15.120 N PROSER2 n/a
2 TRCN0000127853 GCCTGAAGATGTCATCGACTT pLKO.1 1452 CDS 100% 4.050 5.670 N PROSER2 n/a
3 TRCN0000127936 CGCATCTGACATGAACTCAGA pLKO.1 1170 CDS 100% 0.264 0.370 N PROSER2 n/a
4 TRCN0000419227 TCGCTCCAGAAGCTTCACTTT pLKO_005 1260 CDS 100% 4.950 3.960 N PROSER2 n/a
5 TRCN0000130607 CAGAAGATTTCCGAGAGGATG pLKO.1 1738 CDS 100% 4.050 3.240 N PROSER2 n/a
6 TRCN0000427026 CCCTCGTTATGGCGCAGAAGA pLKO_005 1724 CDS 100% 1.650 1.320 N PROSER2 n/a
7 TRCN0000414369 GGACTGGTCTGATTATCATTC pLKO_005 2785 3UTR 100% 10.800 7.560 N PROSER2 n/a
8 TRCN0000128596 GCAAGACTGTTCACTAAAGAA pLKO.1 3464 3UTR 100% 5.625 3.938 N PROSER2 n/a
9 TRCN0000130326 GCTTCACTTTGGATGATGAGA pLKO.1 1271 CDS 100% 3.000 2.100 N PROSER2 n/a
10 TRCN0000127577 CAGCAACATCATCGTCACCAA pLKO.1 1905 CDS 100% 2.640 1.848 N PROSER2 n/a
11 TRCN0000130821 GAAGAGACGATTGACTCCCTA pLKO.1 1339 CDS 100% 2.640 1.848 N PROSER2 n/a
12 TRCN0000128022 GCACAGGAAACAAGATGCTGA pLKO.1 1557 CDS 100% 2.640 1.848 N PROSER2 n/a
13 TRCN0000128023 GCAGAAGATTTCCGAGAGGAT pLKO.1 1737 CDS 100% 2.640 1.848 N PROSER2 n/a
14 TRCN0000127576 CTTTGGATGATGAGAGCCTGA pLKO.1 1277 CDS 100% 2.160 1.512 N PROSER2 n/a
15 TRCN0000446088 TCATCGACTTAGTGCAGCCAG pLKO_005 1463 CDS 100% 2.160 1.512 N PROSER2 n/a
16 TRCN0000127919 CACTTTGGATGATGAGAGCCT pLKO.1 1275 CDS 100% 0.660 0.462 N PROSER2 n/a
17 TRCN0000127575 CTGACATGAACTCAGACACGT pLKO.1 1175 CDS 100% 2.640 1.584 N PROSER2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13458 pDONR223 100% 78.2% 78.1% None 732_1013del;1047C>T;1235C>T n/a
2 ccsbBroad304_13458 pLX_304 0% 78.2% 78.1% V5 732_1013del;1047C>T;1235C>T n/a
3 TRCN0000474922 ATCACTACCCTGGTGTTATACCTT pLX_317 44.7% 78.2% 78.1% V5 732_1013del;1047C>T;1235C>T n/a
Download CSV