Transcript: Human XM_017016031.1

PREDICTED: Homo sapiens chromosome 10 open reading frame 67 (C10orf67), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C10orf67 (256815)
Length:
2830
CDS:
183..1508

Additional Resources:

NCBI RefSeq record:
XM_017016031.1
NBCI Gene record:
C10orf67 (256815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263838 AGTTTGAGGACCGACTGAAAG pLKO_005 238 CDS 100% 10.800 15.120 N C10orf67 n/a
2 TRCN0000282828 ATGTCATGAGCATAGTTATTA pLKO_005 8 5UTR 100% 15.000 10.500 N C10orf67 n/a
3 TRCN0000263839 ATGACAGGATCCTAGAAATTG pLKO_005 289 CDS 100% 13.200 9.240 N C10orf67 n/a
4 TRCN0000167089 CATAGCTGTTATCAAAGGAAT pLKO.1 374 CDS 100% 4.950 3.465 N C10orf67 n/a
5 TRCN0000167066 CATTATCAACAGAATGAGGAT pLKO.1 315 CDS 100% 2.640 1.848 N C10orf67 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10482 pDONR223 100% 13.4% 13.2% None (many diffs) n/a
2 ccsbBroad304_10482 pLX_304 0% 13.4% 13.2% V5 (many diffs) n/a
3 TRCN0000476993 ATCGTGGTGGTCAGCATTATGGTG pLX_317 73.2% 13.4% 13.2% V5 (many diffs) n/a
Download CSV