Transcript: Human XM_017016067.1

PREDICTED: Homo sapiens kinesin family binding protein (KIFBP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIFBP (26128)
Length:
3068
CDS:
1435..2502

Additional Resources:

NCBI RefSeq record:
XM_017016067.1
NBCI Gene record:
KIFBP (26128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165291 GCTGGGTAATGTACCTGGTAA pLKO.1 2831 3UTR 100% 4.950 6.930 N KIFBP n/a
2 TRCN0000159114 GCTTACTATGATATGATGGAT pLKO.1 2074 CDS 100% 3.000 4.200 N KIFBP n/a
3 TRCN0000433172 GACGGTGCAAGATGCATAAAC pLKO_005 1961 CDS 100% 13.200 9.240 N KIFBP n/a
4 TRCN0000435754 TAGCAAGGTGCTGGATCAAAT pLKO_005 1565 CDS 100% 13.200 9.240 N KIFBP n/a
5 TRCN0000166181 CCCTGCCATGTTAGCTAAGTT pLKO.1 2259 CDS 100% 5.625 3.938 N KIFBP n/a
6 TRCN0000161106 GCACTATGTCTTTGAGGCAAA pLKO.1 1836 CDS 100% 4.050 2.835 N KIFBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02919 pDONR223 100% 57.1% 57.1% None 0_1ins798 n/a
2 ccsbBroad304_02919 pLX_304 0% 57.1% 57.1% V5 0_1ins798 n/a
3 TRCN0000466629 CTCTCGTGCCAGATATTTGGACCA pLX_317 19.5% 57.1% 57.1% V5 0_1ins798 n/a
Download CSV