Transcript: Human XM_017016156.1

PREDICTED: Homo sapiens catenin alpha 3 (CTNNA3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTNNA3 (29119)
Length:
9950
CDS:
239..2143

Additional Resources:

NCBI RefSeq record:
XM_017016156.1
NBCI Gene record:
CTNNA3 (29119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164157 CACGGGTGAAATGGACAGTTA pLKO.1 1108 CDS 100% 4.950 6.930 N CTNNA3 n/a
2 TRCN0000160465 CCTGAATATTGCTTTAGACAA pLKO.1 529 CDS 100% 4.950 6.930 N CTNNA3 n/a
3 TRCN0000160322 CGCAAGGCTATTATAGATCAT pLKO.1 587 CDS 100% 4.950 6.930 N CTNNA3 n/a
4 TRCN0000160039 CATACAACTGATGTGATCTAT pLKO.1 1634 CDS 100% 5.625 3.938 N CTNNA3 n/a
5 TRCN0000158421 CCACTAAAGCATACAACTGAT pLKO.1 1625 CDS 100% 4.950 3.465 N CTNNA3 n/a
6 TRCN0000160161 CCTGGAACAGATTAAGTTCTA pLKO.1 1759 CDS 100% 4.950 3.465 N CTNNA3 n/a
7 TRCN0000159368 GAGATTGAGATATGGGATGAT pLKO.1 1523 CDS 100% 4.950 3.465 N CTNNA3 n/a
8 TRCN0000159814 GCTTTCAGAGTACATGAACAA pLKO.1 481 CDS 100% 4.950 3.465 N CTNNA3 n/a
9 TRCN0000160097 CCAAATCAGAGAGATGAAATT pLKO.1 47 5UTR 100% 13.200 7.920 N CTNNA3 n/a
10 TRCN0000108729 CCATCACTAGAGAAACGCCTA pLKO.1 347 CDS 100% 2.160 1.512 N Ctnna3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11900 pDONR223 100% 28.3% 27.8% None (many diffs) n/a
2 ccsbBroad304_11900 pLX_304 0% 28.3% 27.8% V5 (many diffs) n/a
3 TRCN0000477633 TCCCACACCATACCTCTGCGGCTA pLX_317 18% 28.3% 27.8% V5 (many diffs) n/a
Download CSV