Transcript: Human XM_017016159.1

PREDICTED: Homo sapiens B cell linker (BLNK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BLNK (29760)
Length:
4160
CDS:
57..1358

Additional Resources:

NCBI RefSeq record:
XM_017016159.1
NBCI Gene record:
BLNK (29760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359465 TTCGCCAGAGGCGAGTATATA pLKO_005 396 CDS 100% 15.000 21.000 N BLNK n/a
2 TRCN0000029706 GCGAGTATATAGACAATCGAT pLKO.1 406 CDS 100% 3.000 4.200 N BLNK n/a
3 TRCN0000359389 TGATTCCAAACAACCATATAC pLKO_005 1118 CDS 100% 13.200 10.560 N BLNK n/a
4 TRCN0000029707 CCCATACCTCTGCCAAGATTT pLKO.1 906 CDS 100% 13.200 9.240 N BLNK n/a
5 TRCN0000329141 TTGAGGATGAGGCTGATTATG pLKO_005 571 CDS 100% 13.200 9.240 N Blnk n/a
6 TRCN0000029704 GCGATTTATTGAAGCAACAAA pLKO.1 1181 CDS 100% 5.625 3.938 N BLNK n/a
7 TRCN0000029708 CCATGATTCCAAACAACCATA pLKO.1 1115 CDS 100% 4.950 3.465 N BLNK n/a
8 TRCN0000029705 CCCGTGGAAGATAATGATGAA pLKO.1 597 CDS 100% 4.950 3.465 N BLNK n/a
9 TRCN0000298629 GTTCAGGGCCAGTGCATATTA pLKO_005 3423 3UTR 100% 15.000 7.500 Y NPM1 n/a
10 TRCN0000062272 CCTAGTTCTGTAGAAGACATT pLKO.1 3808 3UTR 100% 4.950 2.475 Y NPM1 n/a
11 TRCN0000286484 CCTAGTTCTGTAGAAGACATT pLKO_005 3808 3UTR 100% 4.950 2.475 Y NPM1 n/a
12 TRCN0000062268 GCCAAGAATGTGTTGTCCAAA pLKO.1 4108 3UTR 100% 4.950 2.475 Y NPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08117 pDONR223 99.4% 92.1% 91.8% None (many diffs) n/a
2 ccsbBroad304_08117 pLX_304 10.4% 85.4% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV